blueocean Forum Senior

Topics: 15 Posts: 195
| | 09/17/06 - 07:42 AM  
 
   
 
|   #1 |
HbNl: AAGUAUCACUAAGCUCGC HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal β-globin chain. The normal sequence of the β-globin gene (HbNl) and the sequence of the HbCr β-chain are presented above. Which of the following would account for the development of HbCr? A. A frameshift mutation resulted in the deletion of several amino acid residues in the β-chain B. A mutation in the stop codon resulted in elongation of the β-chain C. A point mutation resulted in the insertion of a stop codon in the β-chain D. A two base pair addition resulted in the elimination of a stop codon in the β-chain E. A two base pair deletion resulted in truncation of the β-chain
|
| vanshita Forum Guru

Topics: 26 Posts: 892
| | 09/17/06 - 09:45 PM  
 
   
 
|   #2 |
D
|
| sridevibandaru24 Forum Guru
Topics: 33 Posts: 434
| | 09/23/06 - 10:45 AM  
 
   
 
|   #3 |
D
|
| drbin Forum Guru

Topics: 27 Posts: 538
| | 09/29/06 - 03:43 AM  
 
   
 
|   #4 |
A
___________________ action speaks better than words
|
| ashfaque Forum Newbie
Topics: 0 Posts: 142
| | 11/10/06 - 10:41 PM  
 
   
 
|   #5 |
D
|
| lq2006 Forum Elite
Topics: 43 Posts: 382
| | 05/25/07 - 04:12 PM  
 
   
 
|   #6 |
D. A two base pair addition resulted in the elimination of a stop codon in the β-chain
|
|
| |
| | | | | | |