Prep for USMLEPrep for USMLE Forum
   Forum    Step 1  Step 2 CK Step 2 CS Step 3  Match  IMGs Resources Search






Previous Topic | Next Topic  q2 




 
Kaplan Qbank USMLE



Author6 Posts
  #1

HbNl: AAGUAUCACUAAGCUCGC

HbCr: AAGAGUAUCACUAAGCUCGCUUUC ... UAU UAA

Hemoglobin is isolated from the erythrocytes of a young child with anemia. Hemoglobin electrophoresis reveals the presence of an unstable hemoglobin, known as hemoglobin Cranston (HbCr), containing an abnormal β-globin chain. The normal sequence of the β-globin gene (HbNl) and the sequence of the HbCr β-chain are presented above. Which of the following would account for the development of HbCr?
A. A frameshift mutation resulted in the deletion of several amino acid residues in the β-chain
B. A mutation in the stop codon resulted in elongation of the β-chain
C. A point mutation resulted in the insertion of a stop codon in the β-chain
D. A two base pair addition resulted in the elimination of a stop codon in the β-chain
E. A two base pair deletion resulted in truncation of the β-chain



  #2

D

  #3

D

  #4

A

___________________
action speaks better than words

  #5

D

  #6

D. A two base pair addition resulted in the elimination of a stop codon in the β-chain








You don't have permission to post.




Login or Register to post messages in this topic





















Contact | Leaders | Disclaimer | Privacy

Copyright @ Prep for USMLE. All rights reserved.